Molecular Diagnosis of Aspergillus Spp Species from Cancer Patients who are suffering from Chest Respiratory Disease

Authors

  • Faiza Majid Najm
  • Sanaa Hussein Mahmood

Abstract

The present study was designed to Isolation and diagnosis of Aspergillus species from cancer patients. A total of two hundred fifty-six (256) were collected from patients (sputum sample), aged between (11-<61 years) who visited the tumor center in Kirkuk city at a period from November 2020 to November 2021. In the current study, the sputum specimens were collected from patients with respiratory tract cancer and infection. 256 samples were directly examined by using microscopic with 10% KOH solution from which a total of 143 samples were found positive while other, 113 samples were negative. The results showed that the highest age group exposed to fungal infection was 41-50 years, while the lowest age group was 11-20 years old. The infection with Aspergillus fumigates 37(43.02%) which represented the highest record detected. A. fumigatus showed a percentage of 100%, followed by A. niger with a percentage of 92.3%. While, the lowest percentage of urease production was by A. parvisclerotigenus, that reached 50%. A. fumigatus showed a percentage of 70.3%, followed by A. niger with a percentage of 53.8%. While, the lowest percentage of protease production was by A. oryzae, that reached 20%. For the purpose of diagnosing DNA purified from local isolates of Aspergillus, global primers were adopted to amplify the ITS1 target region anterior (5' – TCCGTAGGTGAACCTGCGG - 3) and posterior (5' – TCCTCCGCTTATTGATATGC - 3’) as an approved taxonomic and genetic index to study genetic data between different fungal isolates in this region. 5.8S) ITS1 of Aspergillus isolates. The polymerization products were of one molecular size (550) for all bundles. Finally, Infection with A. parvisclerotigenus was recorded, in Gene-bank, for the first time in Iraq through this study.

Downloads

Published

2022-10-30